From Comaiwiki

(Table of TILLING alleles of REVOLUTA)
 
Line 27: Line 27:
  
 
==Table of TILLING alleles of REVOLUTA==
 
==Table of TILLING alleles of REVOLUTA==
All alleles are in Col er background
+
All alleles are in Col ''er'' background
  
 
{| align="left"  border="1" cellpadding="1" cellspacing="0"  
 
{| align="left"  border="1" cellpadding="1" cellspacing="0"  

Latest revision as of 21:21, 23 August 2012

Contents

[edit] REVOLUTA legacy

The Comai laboratory does not work any longer on the REVOLUTA gene. Following our publication in Development we are sometime asked for alleles. The rev-1 allele is available from TAIR. The other alleles described in the paper are no longer available in my laboratory. We distributed seed while available, but the lines seem to have gone to the great fields in the sky. While still in Seattle (around 2005) we searched the TILLING collection of STP for additional alleles. We identified 28 new alleles whose molecular characteristics and TAIR address (CS number) is provided below as a service to the community. A preliminary growth experiment identified at least two alleles that showed strong phenotypes. You should repeat the analysis of phenotype to confirm this.

Credits: The Seattle TILLING Project, by Luca Comai and Steve Henikoff, Funding: NSF

[edit] Phenotype

[edit] Severe

Refer to table of mutants below

  • G581E, STP7870, CS90262 (image below)

7870.png

  • L487F, STP14383, CS93756 (no image available)

[edit] Mild

  • A475T, STP#10363, CS92430 (image below)

10363.png

  • A532V, STP5204, CS87661 (no image available)

[edit] Primers used for TILLING

start: ggtgcttcatgttttaggcgttgcggtatatc

end: ggctccaaattgtccccaggatctcctgaagctg

[edit] Table of TILLING alleles of REVOLUTA

All alleles are in Col er background

mutation change on DNA effect SIFT score zygosity STP number TAIR collection number
i120B6 g223a A403= n Homo 4551 CS87032
i120H7 g204r Intron n Hetero 4725 CS87200
i124B4 c781y A532V 0.63 (3.25) Hetero 5204 CS87661
i124G5 g704r Intron n Hetero 5219 CS87676
i129F3 g587r G496R 0.07 (3.39) Hetero 5560 CS87999
i132F2 c558y T486I 0.04 (3.32) Hetero 5683 CS88122
i137E3 g245r G411R 0.01 (3.25) Hetero 6145 CS88474
i137E5 c493y I464= n Hetero 6161 CS88490
i137G6 g348r G445D 0.03 (3.25) Hetero 6172 CS88501
i152H7 c833t Intron n Homo 7132 CS89560
i157E8 c584t P495S 0.15 (3.34) Homo 7517 CS89917
i160E7 c560y L487F n Hetero 7764 CS90160
i160E7 g50r E373= n Hetero 7764 CS90160
i161C8 g1013r G581E 0.00 (3.25) Hetero 7870 CS90262
i161F5 g880r Intron n Hetero 7820 CS90215
i169A1 g270r G419E 0.00 (3.25) Hetero 9395 CS91666
i174B1 c500y L467F 0.00 (3.25) Hetero 7389 CS89794
i174E8 g760r R525K 0.76 (3.25) Hetero 9769 CS92032
i175D8 c438y Intron n Hetero 12060 CS92971
i179A7 g930a E553= n Homo 12324 CS93229
i189H1 c560y L487F 0.09 (3.32) Hetero 14383 CS93756
i191A2 g246r G411E 0.02 (3.25) Hetero 15115 CS93933
i191A3 c432y INTRON n Hetero 15126 CS93944
i191F3 c464y INTRON n Hetero 15135 CS93952
i192F8 g566r A489T 0.63 (3.32) Hetero 15268 CS94073
i193C3 g854a Intron n Homo 15292 CS94094
i198C3 g524r A475T 0.00 (3.32) Hetero 10363 CS92430
i92D7 g520r E473= n Hetero 2331 CS85496
Personal tools